caption a7 s mutans strains relevant characteristics source ua159 wild type atcc δ adca adca  (ATCC)

Journal: Molecular oral microbiology

Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

doi: 10.1111/omi.12337

Figure Lengend Snippet: Alignment of AdcA of S. mutans with AdcA and AdcAII proteins of S. agalactiae. Dark and light grey shades represent identical and similar residues, respectively. Orange shaded residues are the N-terminal histidine rich metal-binding motif, yellow boxed residues depict the C-terminal ZinT domain while the glutamic acid and additional histidine residues that aid in metal recruitment are indicated in blue shades.

Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

Techniques: Binding Assay

Journal: Molecular oral microbiology

Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

doi: 10.1111/omi.12337

Figure Lengend Snippet: AdcABC mediates the growth of S. mutans under zinc-depleted conditions. Growth curves of UA159, ΔadcA, ΔadcCB or ΔadcCBcomp in (A) FMC, (B) FMC supplemented with 5 μM ZnSO4, (C) BHI, (D) CP/BHI medium containing 200 μg ml−1 of human calprotectin, and (E) BHI containing 10 μM TPEN. Curves shown represent average and standard deviation of at least five independent biological replicates.

Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

Techniques: Standard Deviation

Journal: Molecular oral microbiology

Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

doi: 10.1111/omi.12337

Figure Lengend Snippet: ICP-MS quantifications of intracellular zinc and manganese in the UA159, ΔadcA, ΔadcCB or ΔadcCBcomp strains. The bar graphs indicate zinc or manganese levels in cells grown in BHI (A and C) or BHI containing 6 μM TPEN (B and D). Data represent averages and standard deviations of three independent biological replicates. One-way ANOVA was used to compare the metal content of mutants and UA159 (*) and between ΔadcCB and ΔadcCBcomp (#). A p value <0.05 was considered significant.

Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

Techniques:

Journal: Molecular oral microbiology

Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

doi: 10.1111/omi.12337

Figure Lengend Snippet: The ΔadcCB mutant strain is hypersensitive to manganese. Mid-log grown cultures of UA159, ΔadcCB or ΔadcCBcomp were serially diluted and spotted on BHI agar containing different concentrations of manganese or zinc as indicated in the figure labels.

Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

Techniques: Mutagenesis

Journal: Molecular oral microbiology

Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

doi: 10.1111/omi.12337

Figure Lengend Snippet: Colonization of S. mutans UA159 or ΔadcCB on the teeth of rats. (A) Total S. mutans colonies recovered from rat jaws by plating on MS agar, and (B) percentage of S. mutans colonies among total recovered flora plated on blood agar plates. The limit of detection for CFU is 102. (*) Indicates statistical significance (p = 0.0003 (A) and 0.0002 (B) by Mann-Whitney test).

Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

Techniques: MANN-WHITNEY

Journal: Molecular oral microbiology

Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

doi: 10.1111/omi.12337

Figure Lengend Snippet: Expression of virulence-related attributes in the UA159, ΔadcA and ΔadcCB strains. (A) Growth in in the presence of a sub-inhibitory concentration of H2O2 (0.75 mM) in FMC supplemented with 5 μM (A) or 20 μM ZnSO4 (B). Curves shown represent average and standard deviation of at least five independent biological replicates. (C) 24-h biofilms formed on the surface of saliva-coated microtiter plate wells from cells grown in FMC supplemented with 1% sucrose in presence of varying amount of Zn. (*) Indicates statistical significance when compared to UA159 strain (p < 0.05, one-way ANOVA).

Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

Techniques: Expressing, Concentration Assay, Standard Deviation

Journal: Molecular oral microbiology

Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

doi: 10.1111/omi.12337

Figure Lengend Snippet: Bacterial strains and primers used in the study

Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

Techniques:

Journal: Annals of Translational Medicine

Article Title: Factorial design and post-antibiotic sub-MIC effects of linezolid combined with fosfomycin against vancomycin-resistant enterococci

doi: 10.21037/atm-21-4595

Figure Lengend Snippet: Summary of MIC and FICI values of the 8 enterococci strains

Article Snippet: The FICI values illustrated that linezolid combined with fosfomycin had a synergistic or an additive effect on the 6 strains, had an indifferent effect on the No. 1 and ATCC29212 strains, and did not have an antagonistic effect on any of the strains (see ). table ft1 table-wrap mode="anchored" t5 caption a7 Strains MIC (mg/L) MIC combination FICI VAN LNZ FOS LNZ/FOS LNZ + FOS No. 1 4 2 64 0.03125/64 1.015 No. 2 4 2 128 0.5/32 0.5 No. 3 2 2 128 1/32 0.75 No. 4 2 4 256 0.5/128 0.625 No. 5 1 4 128 1/32 0.5 No. 8 128 2 128 1/32 0.75 ATCC 29212 1 2 128 1/64 1 ATCC 51299 256 2 128 0.5/32 0.5 Open in a separate window VAN: ≤4 mg/L, susceptible (S); 8–16 mg/L, intermediate (I); ≥32 mg/L, resistant (R).

Techniques: