Review



caption a7 strain plasmid relevant genotype  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    ATCC caption a7 strain plasmid relevant genotype
    Caption A7 Strain Plasmid Relevant Genotype, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 19140 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/caption a7 strain plasmid relevant genotype/product/ATCC
    Average 99 stars, based on 19140 article reviews
    caption a7 strain plasmid relevant genotype - by Bioz Stars, 2026-04
    99/100 stars

    Images



    Similar Products

    99
    ATCC caption a7 strain plasmid relevant genotype
    Caption A7 Strain Plasmid Relevant Genotype, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/caption a7 strain plasmid relevant genotype/product/ATCC
    Average 99 stars, based on 1 article reviews
    caption a7 strain plasmid relevant genotype - by Bioz Stars, 2026-04
    99/100 stars
      Buy from Supplier

    96
    ATCC caption a7 s mutans strains relevant characteristics source ua159 wild type atcc δ adca adca
    Alignment of AdcA of S. mutans with AdcA and AdcAII proteins of S. agalactiae. Dark and light grey shades represent identical and similar residues, respectively. Orange shaded residues are the N-terminal histidine rich metal-binding motif, yellow boxed residues depict the C-terminal ZinT domain while the glutamic acid and additional histidine residues that aid in metal recruitment are indicated in blue shades.
    Caption A7 S Mutans Strains Relevant Characteristics Source Ua159 Wild Type Atcc δ Adca Adca, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/caption a7 s mutans strains relevant characteristics source ua159 wild type atcc δ adca adca/product/ATCC
    Average 96 stars, based on 1 article reviews
    caption a7 s mutans strains relevant characteristics source ua159 wild type atcc δ adca adca - by Bioz Stars, 2026-04
    96/100 stars
      Buy from Supplier

    92
    ATCC t5 caption a7 strains mic mg l mic combination fici van lnz fos lnz fos lnz fos no
    Summary of <t> MIC </t> and <t> FICI </t> values of the 8 enterococci strains
    T5 Caption A7 Strains Mic Mg L Mic Combination Fici Van Lnz Fos Lnz Fos Lnz Fos No, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t5 caption a7 strains mic mg l mic combination fici van lnz fos lnz fos lnz fos no/product/ATCC
    Average 92 stars, based on 1 article reviews
    t5 caption a7 strains mic mg l mic combination fici van lnz fos lnz fos lnz fos no - by Bioz Stars, 2026-04
    92/100 stars
      Buy from Supplier

    91
    ATCC caption a7 bacterial strain mic
    Summary of <t> MIC </t> and <t> FICI </t> values of the 8 enterococci strains
    Caption A7 Bacterial Strain Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/caption a7 bacterial strain mic/product/ATCC
    Average 91 stars, based on 1 article reviews
    caption a7 bacterial strain mic - by Bioz Stars, 2026-04
    91/100 stars
      Buy from Supplier

    97
    ATCC caption a7 strain azm
    Summary of <t> MIC </t> and <t> FICI </t> values of the 8 enterococci strains
    Caption A7 Strain Azm, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/caption a7 strain azm/product/ATCC
    Average 97 stars, based on 1 article reviews
    caption a7 strain azm - by Bioz Stars, 2026-04
    97/100 stars
      Buy from Supplier

    Image Search Results


    Alignment of AdcA of S. mutans with AdcA and AdcAII proteins of S. agalactiae. Dark and light grey shades represent identical and similar residues, respectively. Orange shaded residues are the N-terminal histidine rich metal-binding motif, yellow boxed residues depict the C-terminal ZinT domain while the glutamic acid and additional histidine residues that aid in metal recruitment are indicated in blue shades.

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: Alignment of AdcA of S. mutans with AdcA and AdcAII proteins of S. agalactiae. Dark and light grey shades represent identical and similar residues, respectively. Orange shaded residues are the N-terminal histidine rich metal-binding motif, yellow boxed residues depict the C-terminal ZinT domain while the glutamic acid and additional histidine residues that aid in metal recruitment are indicated in blue shades.

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: Binding Assay

    AdcABC mediates the growth of S. mutans under zinc-depleted conditions. Growth curves of UA159, ΔadcA, ΔadcCB or ΔadcCBcomp in (A) FMC, (B) FMC supplemented with 5 μM ZnSO4, (C) BHI, (D) CP/BHI medium containing 200 μg ml−1 of human calprotectin, and (E) BHI containing 10 μM TPEN. Curves shown represent average and standard deviation of at least five independent biological replicates.

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: AdcABC mediates the growth of S. mutans under zinc-depleted conditions. Growth curves of UA159, ΔadcA, ΔadcCB or ΔadcCBcomp in (A) FMC, (B) FMC supplemented with 5 μM ZnSO4, (C) BHI, (D) CP/BHI medium containing 200 μg ml−1 of human calprotectin, and (E) BHI containing 10 μM TPEN. Curves shown represent average and standard deviation of at least five independent biological replicates.

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: Standard Deviation

    ICP-MS quantifications of intracellular zinc and manganese in the UA159, ΔadcA, ΔadcCB or ΔadcCBcomp strains. The bar graphs indicate zinc or manganese levels in cells grown in BHI (A and C) or BHI containing 6 μM TPEN (B and D). Data represent averages and standard deviations of three independent biological replicates. One-way ANOVA was used to compare the metal content of mutants and UA159 (*) and between ΔadcCB and ΔadcCBcomp (#). A p value <0.05 was considered significant.

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: ICP-MS quantifications of intracellular zinc and manganese in the UA159, ΔadcA, ΔadcCB or ΔadcCBcomp strains. The bar graphs indicate zinc or manganese levels in cells grown in BHI (A and C) or BHI containing 6 μM TPEN (B and D). Data represent averages and standard deviations of three independent biological replicates. One-way ANOVA was used to compare the metal content of mutants and UA159 (*) and between ΔadcCB and ΔadcCBcomp (#). A p value <0.05 was considered significant.

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques:

    The ΔadcCB mutant strain is hypersensitive to manganese. Mid-log grown cultures of UA159, ΔadcCB or ΔadcCBcomp were serially diluted and spotted on BHI agar containing different concentrations of manganese or zinc as indicated in the figure labels.

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: The ΔadcCB mutant strain is hypersensitive to manganese. Mid-log grown cultures of UA159, ΔadcCB or ΔadcCBcomp were serially diluted and spotted on BHI agar containing different concentrations of manganese or zinc as indicated in the figure labels.

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: Mutagenesis

    Colonization of S. mutans UA159 or ΔadcCB on the teeth of rats. (A) Total S. mutans colonies recovered from rat jaws by plating on MS agar, and (B) percentage of S. mutans colonies among total recovered flora plated on blood agar plates. The limit of detection for CFU is 102. (*) Indicates statistical significance (p = 0.0003 (A) and 0.0002 (B) by Mann-Whitney test).

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: Colonization of S. mutans UA159 or ΔadcCB on the teeth of rats. (A) Total S. mutans colonies recovered from rat jaws by plating on MS agar, and (B) percentage of S. mutans colonies among total recovered flora plated on blood agar plates. The limit of detection for CFU is 102. (*) Indicates statistical significance (p = 0.0003 (A) and 0.0002 (B) by Mann-Whitney test).

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: MANN-WHITNEY

    Expression of virulence-related attributes in the UA159, ΔadcA and ΔadcCB strains. (A) Growth in in the presence of a sub-inhibitory concentration of H2O2 (0.75 mM) in FMC supplemented with 5 μM (A) or 20 μM ZnSO4 (B). Curves shown represent average and standard deviation of at least five independent biological replicates. (C) 24-h biofilms formed on the surface of saliva-coated microtiter plate wells from cells grown in FMC supplemented with 1% sucrose in presence of varying amount of Zn. (*) Indicates statistical significance when compared to UA159 strain (p < 0.05, one-way ANOVA).

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: Expression of virulence-related attributes in the UA159, ΔadcA and ΔadcCB strains. (A) Growth in in the presence of a sub-inhibitory concentration of H2O2 (0.75 mM) in FMC supplemented with 5 μM (A) or 20 μM ZnSO4 (B). Curves shown represent average and standard deviation of at least five independent biological replicates. (C) 24-h biofilms formed on the surface of saliva-coated microtiter plate wells from cells grown in FMC supplemented with 1% sucrose in presence of varying amount of Zn. (*) Indicates statistical significance when compared to UA159 strain (p < 0.05, one-way ANOVA).

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: Expressing, Concentration Assay, Standard Deviation

    Bacterial strains and primers used in the study

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: Bacterial strains and primers used in the study

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques:

    Summary of  MIC  and  FICI  values of the 8 enterococci strains

    Journal: Annals of Translational Medicine

    Article Title: Factorial design and post-antibiotic sub-MIC effects of linezolid combined with fosfomycin against vancomycin-resistant enterococci

    doi: 10.21037/atm-21-4595

    Figure Lengend Snippet: Summary of MIC and FICI values of the 8 enterococci strains

    Article Snippet: The FICI values illustrated that linezolid combined with fosfomycin had a synergistic or an additive effect on the 6 strains, had an indifferent effect on the No. 1 and ATCC29212 strains, and did not have an antagonistic effect on any of the strains (see ). table ft1 table-wrap mode="anchored" t5 caption a7 Strains MIC (mg/L) MIC combination FICI VAN LNZ FOS LNZ/FOS LNZ + FOS No. 1 4 2 64 0.03125/64 1.015 No. 2 4 2 128 0.5/32 0.5 No. 3 2 2 128 1/32 0.75 No. 4 2 4 256 0.5/128 0.625 No. 5 1 4 128 1/32 0.5 No. 8 128 2 128 1/32 0.75 ATCC 29212 1 2 128 1/64 1 ATCC 51299 256 2 128 0.5/32 0.5 Open in a separate window VAN: ≤4 mg/L, susceptible (S); 8–16 mg/L, intermediate (I); ≥32 mg/L, resistant (R).

    Techniques: